pbluescript sk ii (+) vector plasmid (Agilent technologies)
Agilent technologies is a verified supplier 
Agilent technologies manufactures this product 
90
Structured Review
Agilent technologies
pbluescript sk ii (+) vector plasmid
Pbluescript Sk Ii (+) Vector Plasmid, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pbluescript+sk+(+)+vector/pm39082859-55-10-16
Average 90 stars, based on 1 article reviews
Pbluescript Sk Ii (+) Vector Plasmid, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pbluescript+sk+(+)+vector/pm39082859-55-10-16
Average 90 stars, based on 1 article reviews
pbluescript sk ii (+) vector plasmid - by Bioz Stars,
2026-10
90/100 stars
Images
Related Articles
other:Article Title: Host-induced silencing of the Colletotrichum gloeosporioides conidial morphology 1 gene (CgCOM1) confers resistance against Anthracnose disease in chilli and tomato. Article Snippet: Construction of CgCOM1‐RNAi vector and transformation of chilli and tomato Sense and anti-sense CgCOM1 gene fragments were PCRamplified using the sense (forward: 5′-GGC GCG CCA AGA 1 3 AGC GCA AGGCC-3′ and reverse: 5′-ATT TAA ATA TGT CGG CAA TTTC-3′) and antisense (forward: 5′-TCT AGA AAG AAG CGC AAG GCC-3′ and reverse: 5′-GGA TCC ATG TCG GCA ATT TC-3′) primers, gel purified, ligated into Polymerase Chain Reaction:Article Title: The PGE 2 /Ptger4b pathway regulates ovulation by inducing intracellular actin cytoskeleton rearrangement via the Rho/Rock pathway in the granulosa cells of periovulatory follicles in the teleost medaka. Article Snippet: We have previously shown that the prostaglandin E2/Ptger4b receptor system is involved in ovulation in teleost medaka and induces intracellular actin cytoskeleton rearrangement in the granulosa cells of preovulatory follicles.. In this study, we investigated the signaling pathways through which prostaglandin E2 induces a change in the actin cytoskeleton.. Treating preovulatory follicles with GW627368X (Ptger4b antagonist), a Rho inhibitor, or Y-27632 [Rho-associated protein kinase (Rock) inhibitor] inhibited not only in vitro follicle ovulation but also intracellular actin cytoskeleton rearrangement. Article Title: A central role for cAMP/EPAC/RAP/PI3K/AKT/CREB signaling in LH-induced follicular Pgr expression at medaka ovulation†. Article Snippet: .. The PCR products were phosphorylated, gel-purified and ligated into a Article Title: Calmodulin is involved in the dual subcellular location of two chloroplast proteins Article Snippet: .. Plasmids used for A. tumefaciens transformation were prepared using the QIAfilter plasmid midi kit (Qiagen). ceQORH—The coding region of Arabidopsis ceQORH (AT4G13010) was PCR-amplified using the two flanking primers ceQORHBamHI–N-ter (CCTGGATCCATGGCTGGAAAACTCATG) and ceQORHSacI–C-ter (ACAGAGCTCTTATGGCTCGACAATGATCTTC), and the PCR product was cloned into the Article Title: Conserved repertoire of orthologous vomeronasal type 1 receptor genes in ruminant species Article Snippet: .. PCR amplification (35 cycles) was carried out at 95°C for 1 min, 55-60°C for 1 min, and 72°C for 1 min. Amplified DNA fragments were cloned into a Article Title: Nematode selenoproteome: the use of the selenocysteine insertion system to decode one codon in an animal genome? Article Snippet: .. Constructs for expression in mammalian cells were based on a pCR3.1-Uni vector (Invitrogen) to allow strong expression under the CMV promoter. pTRc-Uni was created by amplifying the coding region of C.elegans TR-Se with primers cTR_Uni_F 5′-GTACCATGAAATCTCTCACCGAGTTATTC-3′ and cTR_Uni_R 5′-GACCCTTCTTAACCTCAGCAACC-3′ and inserting the resulting PCR product into pCR3.1-Uni vector (Invitrogen) according to the manufacturers' protocol. pTRc3-Uni was created by transferring the full-length cDNA fragment NotI/ApaI from initial Plasmid Preparation:Article Title: The PGE 2 /Ptger4b pathway regulates ovulation by inducing intracellular actin cytoskeleton rearrangement via the Rho/Rock pathway in the granulosa cells of periovulatory follicles in the teleost medaka. Article Snippet: We have previously shown that the prostaglandin E2/Ptger4b receptor system is involved in ovulation in teleost medaka and induces intracellular actin cytoskeleton rearrangement in the granulosa cells of preovulatory follicles.. In this study, we investigated the signaling pathways through which prostaglandin E2 induces a change in the actin cytoskeleton.. Treating preovulatory follicles with GW627368X (Ptger4b antagonist), a Rho inhibitor, or Y-27632 [Rho-associated protein kinase (Rock) inhibitor] inhibited not only in vitro follicle ovulation but also intracellular actin cytoskeleton rearrangement. Article Title: Fra2 Is a Co-Regulator of Fep1 Inhibition in Response to Iron Starvation Article Snippet: .. DNA templates for antisense riboprobes were cloned into BamHI and EcoRI sites of the Article Title: A central role for cAMP/EPAC/RAP/PI3K/AKT/CREB signaling in LH-induced follicular Pgr expression at medaka ovulation†. Article Snippet: .. The PCR products were phosphorylated, gel-purified and ligated into a Article Title: Targeted in vitro and in vivo gene transfer into T Lymphocytes: potential of direct inhibition of allo-immune activation Article Snippet: .. The enhancer region was isolated from the plasmid following restriction digestion with BamHI and cloned into the BamHI site of the Article Title: Calmodulin is involved in the dual subcellular location of two chloroplast proteins Article Snippet: .. Plasmids used for A. tumefaciens transformation were prepared using the QIAfilter plasmid midi kit (Qiagen). ceQORH—The coding region of Arabidopsis ceQORH (AT4G13010) was PCR-amplified using the two flanking primers ceQORHBamHI–N-ter (CCTGGATCCATGGCTGGAAAACTCATG) and ceQORHSacI–C-ter (ACAGAGCTCTTATGGCTCGACAATGATCTTC), and the PCR product was cloned into the Article Title: Conserved repertoire of orthologous vomeronasal type 1 receptor genes in ruminant species Article Snippet: .. PCR amplification (35 cycles) was carried out at 95°C for 1 min, 55-60°C for 1 min, and 72°C for 1 min. Amplified DNA fragments were cloned into a Clone Assay:Article Title: Fra2 Is a Co-Regulator of Fep1 Inhibition in Response to Iron Starvation Article Snippet: .. DNA templates for antisense riboprobes were cloned into BamHI and EcoRI sites of the Article Title: Targeted in vitro and in vivo gene transfer into T Lymphocytes: potential of direct inhibition of allo-immune activation Article Snippet: .. The enhancer region was isolated from the plasmid following restriction digestion with BamHI and cloned into the BamHI site of the Article Title: Calmodulin is involved in the dual subcellular location of two chloroplast proteins Article Snippet: .. Plasmids used for A. tumefaciens transformation were prepared using the QIAfilter plasmid midi kit (Qiagen). ceQORH—The coding region of Arabidopsis ceQORH (AT4G13010) was PCR-amplified using the two flanking primers ceQORHBamHI–N-ter (CCTGGATCCATGGCTGGAAAACTCATG) and ceQORHSacI–C-ter (ACAGAGCTCTTATGGCTCGACAATGATCTTC), and the PCR product was cloned into the Article Title: Conserved repertoire of orthologous vomeronasal type 1 receptor genes in ruminant species Article Snippet: .. PCR amplification (35 cycles) was carried out at 95°C for 1 min, 55-60°C for 1 min, and 72°C for 1 min. Amplified DNA fragments were cloned into a Isolation:Article Title: Targeted in vitro and in vivo gene transfer into T Lymphocytes: potential of direct inhibition of allo-immune activation Article Snippet: .. The enhancer region was isolated from the plasmid following restriction digestion with BamHI and cloned into the BamHI site of the Transformation Assay:Article Title: Calmodulin is involved in the dual subcellular location of two chloroplast proteins Article Snippet: .. Plasmids used for A. tumefaciens transformation were prepared using the QIAfilter plasmid midi kit (Qiagen). ceQORH—The coding region of Arabidopsis ceQORH (AT4G13010) was PCR-amplified using the two flanking primers ceQORHBamHI–N-ter (CCTGGATCCATGGCTGGAAAACTCATG) and ceQORHSacI–C-ter (ACAGAGCTCTTATGGCTCGACAATGATCTTC), and the PCR product was cloned into the Amplification:Article Title: Conserved repertoire of orthologous vomeronasal type 1 receptor genes in ruminant species Article Snippet: .. PCR amplification (35 cycles) was carried out at 95°C for 1 min, 55-60°C for 1 min, and 72°C for 1 min. Amplified DNA fragments were cloned into a Construct:Article Title: Nematode selenoproteome: the use of the selenocysteine insertion system to decode one codon in an animal genome? Article Snippet: .. Constructs for expression in mammalian cells were based on a pCR3.1-Uni vector (Invitrogen) to allow strong expression under the CMV promoter. pTRc-Uni was created by amplifying the coding region of C.elegans TR-Se with primers cTR_Uni_F 5′-GTACCATGAAATCTCTCACCGAGTTATTC-3′ and cTR_Uni_R 5′-GACCCTTCTTAACCTCAGCAACC-3′ and inserting the resulting PCR product into pCR3.1-Uni vector (Invitrogen) according to the manufacturers' protocol. pTRc3-Uni was created by transferring the full-length cDNA fragment NotI/ApaI from initial Expressing:Article Title: Nematode selenoproteome: the use of the selenocysteine insertion system to decode one codon in an animal genome? Article Snippet: .. Constructs for expression in mammalian cells were based on a pCR3.1-Uni vector (Invitrogen) to allow strong expression under the CMV promoter. pTRc-Uni was created by amplifying the coding region of C.elegans TR-Se with primers cTR_Uni_F 5′-GTACCATGAAATCTCTCACCGAGTTATTC-3′ and cTR_Uni_R 5′-GACCCTTCTTAACCTCAGCAACC-3′ and inserting the resulting PCR product into pCR3.1-Uni vector (Invitrogen) according to the manufacturers' protocol. pTRc3-Uni was created by transferring the full-length cDNA fragment NotI/ApaI from initial Transferring:Article Title: Nematode selenoproteome: the use of the selenocysteine insertion system to decode one codon in an animal genome? Article Snippet: .. Constructs for expression in mammalian cells were based on a pCR3.1-Uni vector (Invitrogen) to allow strong expression under the CMV promoter. pTRc-Uni was created by amplifying the coding region of C.elegans TR-Se with primers cTR_Uni_F 5′-GTACCATGAAATCTCTCACCGAGTTATTC-3′ and cTR_Uni_R 5′-GACCCTTCTTAACCTCAGCAACC-3′ and inserting the resulting PCR product into pCR3.1-Uni vector (Invitrogen) according to the manufacturers' protocol. pTRc3-Uni was created by transferring the full-length cDNA fragment NotI/ApaI from initial |